MIC11107 Research Skills – Molecular Analysis Assignment Sample 2024

Task One: Transformation efficiency

Question 1

The calculations of the experiment are as follows.

Therefore the transformation efficiency is 2.72 x 10⁵ cfu/µg

Question 2

Control is always maintained in performing experiments. The purpose of the control is for comparing with the tests and evaluates the changes in the test samples. In case of transformation, a control plate is kept which is non-transformed, this allows the researcher to transform a new batch of cells in case the present plate gets contaminated or the results are unsatisfactory.

Question 3

While working at a microbiology laboratory, precautions need to be maintained. Contamination of plates and samples is the most common aspect if not maintained proper protocols and SOPs for performing experiments. In the case of preparing transformed cells, several safety procedures need to be maintained while plating. The whole plating process needs to be done inside a biosafety cabinet or laminar airflow machine, which prevents the flow of microorganisms and other contaminants in the petri dish. The inoculation loop and other components like the pipette needs to be well sanitized. It is always advisable to wear clean gloves before performing plating. The inoculation loop needs to be held on the naked flame of the Bunsen burner and then after few seconds, the process of inoculation needs to be carried out. Plating can be done in the streak method or pour method. The streak method involves striking transformed cells in a fresh agar plate whereas the pour plate indicates the pouring of diluted cells over the agar plate. Any mistake in these steps will result in contamination and failure of the whole experiment. Thus maintaining proper sanitary techniques and protocols are necessary before the platting of transformed cells.

Task Two: Colony screening by PCR

Question 4

The forward primer for the T7 promoter is 5´- TAATACGACTCACTATAGGG – 3´ which has a C + G ratio of 40

The forward primer for the SP6 promoter is 5´- ATTTAGGTGACACTATAG – 3´ which has a C + G ratio of 33

For sequences larger than thirteen nucleotides, the T_m value is calculated via the formula

Tm= 64.9 +41 x (yG+zC-16.4) ÷ (wA+xT+yG+zC)

[Where w. x, y, and z are the bases A. T, G, C respectively]

Therefore,

 The T_m of T7 primer is 47.7°C

The T_m of SP6 primer is 41.2°C

Question 5

From the provided table, it is clearly visible that, from the six labelled colonies, colony no-1, colony no-2 and colony no-5 show the band after the agarose gel electrophoresis run, which ensured that these three colonies contain the FolP insert.

Question 6

From the provided information it can be stated that the size of the FolP insert is in-between 400bp-500bp.

Question 7

A no-template control (NTC) omits any DNA or RNA template from a reaction and serves as a general control for extraneous nucleic acid contamination. When using SYBR Green chemistry, this also serves as an important control for primer dimer formation. Within the RT2 Profiler PCR Arrays, the GDC well also serves as a no template control, as this assay is designed to detect Genomic DNA.

Task Three: Cell Viability

Question 8 a)

After setting up the hemocytometer, and a sample containing 500µl suspension cells and 500µl Trypan Blue solution has been loaded to hemocytometer. Soon the dead cells acquire the color and turn blue while the living cells do not take up the color and remain green. After counting the live cells in each quadrant consisting of16 squares, it has been found that the quadrants have a 100 number. The calculation is as follows:

Sum of live cells from all the quadrants = (30+21+27+22) = 100

Average cell count = (100 ÷ 4) = 25

Total cell count = 25 x 10,000 (10⁴) = 1250000 =125 x 10⁴  

Live cells per µl = 1250000 x 5 = 6250000 = 625 x 10⁴  

Thus there are 625 x 10⁴ live cells in the solution.

1. b) Cell viability is determined by the ratio of live and dead cells that could be counted in the

Sum of dead cells from all quadrants = (8+8+9+9) = 34

Average cell count = (34 ÷ 4) = 8.5

Total cell count = 8.5 x 10,000 (10⁴) = 85000 = 85 x10³  

Dead cells per µl = 85000 x 5 = 425000 = 425 x10³  

There are 425 x10³ dead cells in the solution.

Therefore, the total number of cells consisting of both and dead cells are

6250000+425000 = 6675000

Percentage of viable cells

6675000 ÷ 6250000 = 93.63 % viability

1. c) The Trypan Blue is a diazo dye. The dye is unable to penetrate the cell membrane of live cells as they are intact and the negatively charged elements stop the cells to accept the dye, thus the live cells do not take up the color. On the other hand, the dead cells have damaged cell membranes, and thus the dye passes through the damaged cell membranes and stains the cells. This makes the dead cells appear blue when observed under the hemocytometer.
2. d) While working at a microbiology laboratory, precautions needs to be maintained. Contamination of plates and samples is the most common aspect if not maintained proper protocols and SOPs for performing experiments. In the case of preparing transformed cells, several safety procedures need to be maintained while plating. The contaminants can be of various types, and like chemical contamination, microbial contamination, and viral contamination.

Task Four: Health and Safety

Question 9

All these contaminations have various techniques of detection. For microbial contamination, the samples can be screened for abnormalities and checked for bacterial growth, if detected, then the contaminant can be observed under a microscope and determine what type of microbial growth it is. Generally, it is advised to discard all the contaminated samples and start the experiments afresh.

Task Five: Protein quantification

References

Green, M.R. and Sambrook, J., 2020. Transformation of Escherichia coli by Electroporation. Cold Spring Harbor Protocols, 2020(6), pp.pdb-prot101220.

Kwizera, R., Akampurira, A., Kandole, T.K., Nielsen, K., Kambugu, A., Meya, D.B., Boulware, D.R. and Rhein, J., 2017. Evaluation of trypan blue stain in a haemocytometer for rapid detection of cerebrospinal fluid sterility in HIV patients with cryptococcal meningitis. BMC microbiology, 17(1), pp.1-7.

Mendes, G.P., Kluskens, L.D., Lanceros-Méndez, S. and Mota, M., 2021. Magnesium aminoclays as plasmid delivery agents for non-competent Escherichia coli JM109 transformation. Applied Clay Science, 204, p.106010.

SYNTHETICPEPTIDE, O.B.I., Methods: Inthisresearch, aftercloning ofcodingsequencesofthetargetgene intothepTYB21 plasmid, it was used for transformation of E. coli BL21 (DE3) cells, and the expression was optimizedthroughchangesingrowth temperature, IPTGconcentration, andtheinductiontime-length. Finally the recombinantproteinwaspurifiedby chitincolumnusing DTT. Results: Inductionofthe proteinexpressionwasstartedby 0.5 mMIPTG, at300C andfor 4h.

Watts, J., 2019. Development of a fluorescent computer‐assisted spermatozoal quantification method and a comparison of results for manual counting with a haemocytometer and computer‐assisted semen analysis in dogs. Reproduction in Domestic Animals, 54(11), pp.1477-1488.

Know more about UniqueSubmission’s other writing services:

Assignment Writing Help

Essay Writing Help

Dissertation Writing Help

Case Studies Writing Help

MYOB Perdisco Assignment Help

Presentation Assignment Help

Proofreading & Editing Help